View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_66 (Length: 352)
Name: NF1459_high_66
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 14 - 305
Target Start/End: Complemental strand, 50613684 - 50613393
Alignment:
| Q |
14 |
agacaaactatcatagcaatatttcaccaagcaactatgatggcagcnnnnnnncagtatggcagaagatttggaaaaagctaaaaagagataagaagaa |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50613684 |
agacaaattatcatagcaatatttcaccaagcaactatgatggtagcaaaaaaacagtatggcagaagatttggaaaaagctaaaaagagataagaagaa |
50613585 |
T |
 |
| Q |
114 |
agttttcaattctccttctccttctactatagttgaagatggtgtatcatatgatcaagatacatactcaatgaattttgatcatggaacaggttggatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50613584 |
agttttcaattctccttctccttctactatagttgaagatggtgtatcatatgatcaagatacatactcaatgaattttgatcatggaacaggttggatg |
50613485 |
T |
 |
| Q |
214 |
gaaccagataatctccctcgttcattttcagctcggtatgctgatccatgttggatcttaccacctaaatatttagttggtcgatgattata |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50613484 |
gaaccagataatctccctcgttcattttcagctcggtatgctgatccatgttggatcttaacacctaaatatttagttggtcgatgattata |
50613393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 277
Target Start/End: Original strand, 1025822 - 1025936
Alignment:
| Q |
163 |
tatgatcaagatacatactcaatgaattttgatcatggaacaggttggatggaaccagataatctccctcgttcattttcagctcggtatgctgatccat |
262 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||| | |||| || |||||||| || ||||||||||||||||| || || || |||||||||| |||| |
|
|
| T |
1025822 |
tatgatgaagaatcatactcaatgaactttgataaaggaagtgggtggatggagcctgataatctccctcgttctttctcttctaggtatgctgacccat |
1025921 |
T |
 |
| Q |
263 |
gttggatcttaccac |
277 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
1025922 |
ctaggatcttaccac |
1025936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University