View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_72 (Length: 338)
Name: NF1459_high_72
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 44475202 - 44475452
Alignment:
| Q |
1 |
atatttgaaatgttatttcatataatatacatctctatcattaaatattttatattcaactgttctatgtctcgaatgtgattgacaaaacaatatgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| | | |
|
|
| T |
44475202 |
atatttgaaatgttatttcatata-tatacatctctatcattaa-tattttatattcaactgttctatgtctcgaatgtgattgataaaacaatatatgt |
44475299 |
T |
 |
| Q |
101 |
catttttcaaaagagtagtcaaactttcaaagtcttgtttaacgg---------gagggtagatgtgaagtttgagtaatcttacacattagttgtcatg |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44475300 |
cattgttcaaaagagtagtcaaactttcaaagtcttgtttaacggaaaacacgagagggtagatgtgaagtttgagtaatcttacacattagttgtcatg |
44475399 |
T |
 |
| Q |
192 |
atgnnnnnnngacaaaattagttgtcatgatgatgttgttggcggaaaagagc |
244 |
Q |
| |
|
||| |||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
44475400 |
atgtttttttgacaaaattagttgtcatgatgctgttgtcggcggaaaagagc |
44475452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University