View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_81 (Length: 315)
Name: NF1459_high_81
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 20 - 142
Target Start/End: Original strand, 8036023 - 8036144
Alignment:
| Q |
20 |
taattatttagagtaattccatttctgttttcaagcaacgattatgcaagttgctcaaaatcacaaaaggcaattactatcaccgtattcaaaaaaccaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036023 |
taattatttagagtaattccatttctgttttcaagca-ctataatgcaagttgctcaaaatcacaaaaggcaattactatcaccgtattcaaaaaaccaa |
8036121 |
T |
 |
| Q |
120 |
taaggatgattgaaacattatta |
142 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
8036122 |
taaggatgatttaaacattatta |
8036144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 185 - 303
Target Start/End: Original strand, 8036190 - 8036308
Alignment:
| Q |
185 |
tacgtagtcttgatattgtttcgttgaggacggtaaacaaccatcaaataaccgtcaaagtgacctgttataccttcctcgtttggttcacccgaaataa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036190 |
tacgtagtcttgatattgtttcgttgaggacggtaaacaaccattaaataaccgtcaaagtggcctgttataccttcctcgtttggttcacccgaaataa |
8036289 |
T |
 |
| Q |
285 |
acattaaataatatataat |
303 |
Q |
| |
|
||||||| | ||||||||| |
|
|
| T |
8036290 |
acattaatttatatataat |
8036308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University