View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_93 (Length: 284)
Name: NF1459_high_93
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_93 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 284
Target Start/End: Complemental strand, 48536115 - 48535845
Alignment:
| Q |
15 |
gagcaggttgttttctctgacccatacaaagtttctgagtataatcgttggacttcacctaatcttgaccgtgatgctgaggctgttcgggaagacaatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536115 |
gagcaggttgttttctctgacccatataaagtttctgagtataatcgttggacttcacctaatcttgaccgtgatgctgaggctgttcgggaagacaatc |
48536016 |
T |
 |
| Q |
115 |
tactgaagcttgaagttgctgagctaaaatcaaagtattatatatgtctcacactctcac-tttcttcttcttttaatgcagtagttttgttgtttgggt |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536015 |
tactaaagcttgaagttgctgagctaaaatcaaagtattatatatgtctcacactctcactttttttcttcttttaatgcagtagttttgttgtttgggt |
48535916 |
T |
 |
| Q |
214 |
ttttgttgatgaaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctac |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48535915 |
ttttgttgatgaaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctac |
48535845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University