View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_96 (Length: 280)
Name: NF1459_high_96
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_96 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 29509468 - 29509201
Alignment:
| Q |
1 |
cacccaatcctcttcctttgattccatcacaactcttctcaaacaactcaaatcctccggttccatcccaaacgccaccactttcgttacccttatccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29509468 |
cacccaatcctcttcctttgattccatcacaactcttctcaaacaactcaaatcctccggttccatcccaaacgccaccactttcgctacccttatccaa |
29509369 |
T |
|
| Q |
101 |
agttttaccaatttccatgaaattgaaaacttgcttaagatattggaaaatgaattagggtttaaaccagataccaatttttacaatattgccctcaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29509368 |
agttttaccaatttccatgaaattgaaaacttgcttaagatattggaaaatgaattagggtttaaaccagataccaatttttacaatattgccctcaatg |
29509269 |
T |
|
| Q |
201 |
ctctagttgaggacaataagcttaagctagttgaaatgcttcattccaagatggttaatgaggatatt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29509268 |
ctctagttgaggacaataagcttaagctagttgaaatgcttcattccaagatggttaatgagggtatt |
29509201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University