View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_98 (Length: 278)
Name: NF1459_high_98
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 41463589 - 41463346
Alignment:
| Q |
16 |
ctgttcatacaacttggaattctttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttact |
115 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41463589 |
ctgttcatacaacttggaataccttacctctaggtacaaaccaatagcttgtcttagtgattactccaagtacaacgtttttgcaacaccttcacttact |
41463490 |
T |
|
| Q |
116 |
gcgtttgtgcacttgtcgtctgtctgtgatttggttgatactgttaacgtgccggttcaatcgccgttttttgatcaagtgttgtcgtctgaactaaatg |
215 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41463489 |
gtgtttgtgcacttgtcgtctgtctgtgatttggttgataccgttaacgtgccggttcaatcgccgttttttgatcaagtgttgtcgtctgaactaaatg |
41463390 |
T |
|
| Q |
216 |
atgatcttcggttgtcgtggaattcaccgccatgtggaagatgt |
259 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41463389 |
atgatctccggttgtcgtggaattcaccgccatgtggaagatgt |
41463346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University