View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_101 (Length: 278)
Name: NF1459_low_101
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_101 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 43291119 - 43291385
Alignment:
| Q |
1 |
agatatatatggttactactcccaacacaggctggcttaagtgggatgaatgaattgaggcttcttggacggacgccaattatatttattttccatgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291119 |
agatatatatggttactactcccaacacaggctggcttaagtgggatgaatgaattgaggcttcttggacggacgccaattatatttattttccatgttg |
43291218 |
T |
 |
| Q |
101 |
acatgacatgagcattcaaccggagactctagctagctaataatgcctcaacagaacataccctttccccctggacacattcaggaatatctcatatcct |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291219 |
acatgacatgagcattcaacatgagactctagctagctaataatgcctcaacagaacataccttttccccctggacacattcaggaatatctcatatcct |
43291318 |
T |
 |
| Q |
201 |
atatcatcccaannnnnnnnnnnnggatcattttgatgcttccaattatatttgtttatttctgatga |
268 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43291319 |
atatcatcccaa-ttattttttttggatcattttgatgcttccaattatatttgtttatttcttatga |
43291385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University