View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_113 (Length: 259)
Name: NF1459_low_113
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_113 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 239
Target Start/End: Original strand, 32988195 - 32988399
Alignment:
| Q |
35 |
aatattccaatttcacccttgttagctttgcataaacttgatttcactttgaaccagcagttattcatcatgccctgaacaaatgcatagtaaaagcttg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988195 |
aatattccaatttcacccttgttagctttgcataaacttgatttcactttgaaccagcagttattcatcatgccctgaacaaatgcatagtaaaagcttg |
32988294 |
T |
 |
| Q |
135 |
ttaattcagatgctttattaaagcaaagttttaacgtgatttacgccctcagtcaataaaaattgatatatttgaaccaaatttaagaccaaatacgtta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32988295 |
ttaattcagatgctttattaaagcaaagttttaacgtgatttacgccctcagttaataaaaattgatatatttgaaccaaatttttgaccaaatacgtta |
32988394 |
T |
 |
| Q |
235 |
acttt |
239 |
Q |
| |
|
||||| |
|
|
| T |
32988395 |
acttt |
32988399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University