View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_142 (Length: 241)
Name: NF1459_low_142
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_142 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 3 - 148
Target Start/End: Complemental strand, 5294208 - 5294063
Alignment:
| Q |
3 |
tttaacttgactataccttgttttcttccacttttgttaccatattttccaccaatatcaaaacatgaaggttgagaaatcttcttttctttctgcataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5294208 |
tttaacttgactataccttgttttcttccacttttgttaccatattttccaccaatatcaaaacatgaaggttgagaaatcttcttttctttctgcttaa |
5294109 |
T |
 |
| Q |
103 |
tttttgcatgatttgaatctgaattgattctcatatgtttcaactt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5294108 |
tttttgcatgatttgaatctgaattgattctcatatgtttcaactt |
5294063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University