View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_146 (Length: 237)
Name: NF1459_low_146
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_146 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 43113965 - 43114197
Alignment:
| Q |
1 |
tttcgtcgtttgtttcttggttcatttaattgtcattccattttgaggttgtttgtagtctgcttacnnnnnnnnn-cttttcttagagcacaatgccat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43113965 |
tttcgtcgtttgtttcttggttcatttaattgtcgttccattttgaggttgtttgtagtctgcttacttttttttttcttttcttagagcacaatgccat |
43114064 |
T |
|
| Q |
100 |
ttacaatcgaccattgacaatcatatgcagctcaccaaaaatgtattaaaaagaac---------caaaataatgaagggaggctgaatcaaatccatga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43114065 |
ttacaatcgaccattgacaatcatatgcagctcaccaaaaatgtattaaaaagaacaaaaagaaacaaaataatgaagggaggccgaatcaaatccatga |
43114164 |
T |
|
| Q |
191 |
aataagagtcactcaaatctattactacttact |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43114165 |
aataagagtcacttaaatctattactacttact |
43114197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University