View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_147 (Length: 237)
Name: NF1459_low_147
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_147 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 50595512 - 50595734
Alignment:
| Q |
1 |
agggaacgtgaatttgtctggaaaaactgaatttgttgaatgtgtgagcatttgaatgaagacagagattgccgaagaatggtggcgattgtgagcgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50595512 |
agggaacgtgaatttgtctggaaaaactgaatttgttgaatgtgtgagcatttgaacgaagacagagattgctgaagaatggtggcgattgtgagcgtag |
50595611 |
T |
|
| Q |
101 |
gttctgatgatagcgttgtaggtgaagatatttgggtgaaggagttgcttgaagagcaaggtagcgtaacgcacgtgacccaagttgtcgcatgaatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50595612 |
gttctgatgatagcgttgtaggtgaagatatttgggtgaaggagttgcttgaagagcagggtagcgtaactcacgtgacccaagttgtcgcatgaatcca |
50595711 |
T |
|
| Q |
201 |
acattttggtgactaaaaagttg |
223 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
50595712 |
acatttttgtgactaaaaagttg |
50595734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University