View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_148 (Length: 236)
Name: NF1459_low_148
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_148 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 54424449 - 54424233
Alignment:
| Q |
16 |
cactatgcagagtaaagtagcttctttattgctccaggaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttttcatgc |
115 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
54424449 |
cactatgcagaataaattagcttctttattgctccaggaagcaacgttcaaaaatattttggctcgcagacggggacacaaacaacaacttttttcatgc |
54424350 |
T |
|
| Q |
116 |
ttcagcgttagccaggaaaagtaaaaatatggtaaagaagcttcgtgacaattctggtaattgggttacatcacatgaagacctctgcactctcgttcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54424349 |
ttcagcgttagccaggaaaagtaaaaatatggtaaagaagcttcgtgacaattctggtaattgggttacatcacatgaagacttctgcactctcgttcat |
54424250 |
T |
|
| Q |
216 |
aattacttcatctctct |
232 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
54424249 |
aattacttcacctctct |
54424233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 53 - 230
Target Start/End: Original strand, 20120444 - 20120621
Alignment:
| Q |
53 |
gaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttttcatgcttcagcgttagccaggaaaagtaaaaatatggtaaag |
152 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||| | || ||||||||||||| ||||||||||||||||| | | |||||||| |||||||| ||||| |
|
|
| T |
20120444 |
gaagcagcgttcgaaaattttttggctcgcgaaaggggacacaaacagcagattttttcatgcttcagcatctgtcaggaaaaataaaaatacaataaag |
20120543 |
T |
|
| Q |
153 |
aagcttcgtgacaattctggtaattgggttacatcacatgaagacctctgcactctcgttcataattacttcatctct |
230 |
Q |
| |
|
||||| ||||||| ||| | ||||||| |||| | ||||||||||| || |||| |||||||| ||||||| |||| |
|
|
| T |
20120544 |
aagctacgtgacagttcagttaattggattacggcgcatgaagacctttgtgctcttgttcataactacttcacctct |
20120621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 118
Target Start/End: Original strand, 30168276 - 30168342
Alignment:
| Q |
52 |
ggaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttttcatgcttc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||| | || ||||||| ||||||||| || ||||| ||||| |
|
|
| T |
30168276 |
ggaagcagcgttcaaaaatattttggctatctgagggtgacataaacagcaagttctttcacgcttc |
30168342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University