View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_150 (Length: 235)
Name: NF1459_low_150
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_150 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 93 - 222
Target Start/End: Original strand, 2445515 - 2445644
Alignment:
| Q |
93 |
gtccgtgtattttggcacacacatagagaagttgtgctcatgatatttgttgtagttaagtaagattaatgtannnnnnncctttggtagaagacattgt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2445515 |
gtccgtgtattttggcacacacatagagaagttgtgctcatgatatttgttgtagttaagtaagattaatgtatttttttcctttggtaaaagacattgt |
2445614 |
T |
|
| Q |
193 |
atttctatttcaaccacattgacctatgct |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
2445615 |
atttctatttcaaccacattgacttatgct |
2445644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University