View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1459_low_152 (Length: 234)

Name: NF1459_low_152
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1459_low_152
NF1459_low_152
[»] chr7 (2 HSPs)
chr7 (1-185)||(24947255-24947439)
chr7 (3-51)||(24942690-24942738)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 24947255 - 24947439
Alignment:
1 acataaacactagagaatcaaataaataagtactattgaaaggtataagtaaaacattaacaagtatatggaaattgggactatatccaaatagacgcaa 100  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |    
24947255 acataaacactagggaatcaaataaataagtactattgaaagctataagtaaaacattaacaagtatgtggaaattgggactatatccaaatagacgcga 24947354  T
101 gagttacagtaaatgaatgaactcacgagctaagatagaataggattgaaagcattatcgatttagttagggaagcacctattaa 185  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| |||||||||||| |||||||||||||    
24947355 gagttacagtaaatgaatgaactcacgagtcaagatagaataggattgaaagcattattgatttagttaggcaagcacctattaa 24947439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 3 - 51
Target Start/End: Original strand, 24942690 - 24942738
Alignment:
3 ataaacactagagaatcaaataaataagtactattgaaaggtataagta 51  Q
    |||||||||| ||||||||||||||||||||||||||||| | ||||||    
24942690 ataaacactaaagaatcaaataaataagtactattgaaagttgtaagta 24942738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University