View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_157 (Length: 229)
Name: NF1459_low_157
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_157 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 31662675 - 31662483
Alignment:
| Q |
17 |
caaaggctaagaatttagtatttttggactattctct--agtttcccaacccaaattttcgannnnnnnnnnnnnnngaatttagagtttattgttgaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || ||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
31662675 |
caaaggctaagaatttagtatttttggaatattctctctaggttcccaacccaaattctcgattttttttttt----gaaattagagtttattgttgaag |
31662580 |
T |
 |
| Q |
115 |
gtttatttcttgtagacattgtatctcttctaaacaaaaccatgtgactcaccaagtataaaagacatcctattccagaattatcacaatgccaaag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31662579 |
gtttatttcttgtagacattgtatctcttctaaacaaaaccatgtgactcaccaagtataaaagacatcctattccagaattatcacaatgccaaag |
31662483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 9084681 - 9084731
Alignment:
| Q |
161 |
actcaccaagtataaaagacatcctattccagaattatcacaatgccaaag |
211 |
Q |
| |
|
||||||||||||||||||||| || |||||||| | |||| |||||||||| |
|
|
| T |
9084681 |
actcaccaagtataaaagacaaccaattccagattcatcagaatgccaaag |
9084731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University