View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_169 (Length: 218)
Name: NF1459_low_169
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_169 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 104 - 198
Target Start/End: Complemental strand, 22579716 - 22579622
Alignment:
| Q |
104 |
aaacacaaccgccatagaaagtggaaacccatcaatttaattgaaaaatgttagtaaattaattgttatagcattagtttttctgtttcctctaa |
198 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
22579716 |
aaactcaatcgccatggaaagtggaaacccatcaatttaattggaaaatgttagtaaattaattgttatagcattagtttttctctttcgtctaa |
22579622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University