View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_183 (Length: 204)
Name: NF1459_low_183
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_183 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 7 - 204
Target Start/End: Original strand, 37992804 - 37992997
Alignment:
| Q |
7 |
tagataattctaagtttaaactttagaagctagcacgaatgcactgccaacctgtacggagctagaagctttaggtgccagcatatttaaattctaaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37992804 |
tagataattctaagtttaaactttagaagctagcacgaatgcactgccaacctgtacggagctagaagctttaggtgccagcatatttaaattctaaaag |
37992903 |
T |
|
| Q |
107 |
caggtaggaattgatgcttatattatatcccacttatcaaacgcatcggtgtttgattcatgtatattccatactaaattctcttttggttcatctaa |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||| |||| | | ||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
37992904 |
caggt----attgatgcttatattatatcccacttctcaaaagcataggtggtaggttcatgtatattccagaataaattctcttttggttcatctaa |
37992997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University