View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_61 (Length: 376)
Name: NF1459_low_61
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 13 - 214
Target Start/End: Original strand, 749051 - 749252
Alignment:
| Q |
13 |
aatatttaatgacgtggcaaatcacaatcaaattccaatttctcaattttcatttannnnnnnccttcttcttctcccacaacaacaacaagacctgaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749051 |
aatatttaatgacgtggcaaatcacaatcaaattccaatttctcaattttcatttatttttttccttcttcttctcccacaacaacaacaagacctgaat |
749150 |
T |
|
| Q |
113 |
gaatcactgagtcagtgacgaccaagaccagaaacacaagcttaattaaacaaacaaatctcatgttaatcttatgctaattcccacaaaatgaggttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749151 |
gaatcactgagtcagtgacgaccaagaccagaaacacaagcttaattaaacaaacaaatctcatgttaatcttatgctaattcccacaaaatgaggttta |
749250 |
T |
|
| Q |
213 |
ga |
214 |
Q |
| |
|
|| |
|
|
| T |
749251 |
ga |
749252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 272 - 359
Target Start/End: Original strand, 749319 - 749406
Alignment:
| Q |
272 |
gtcaccgcggatactcgtagccccaaaaatgtccaaactgcccttcgcgctaaatggtccggtactcctcttctcttagaagccaggt |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749319 |
gtcaccgcggatactcgtagccccaaaaatgtccaaactgcccttcgcgctaaatggtccggtactcctcttctcttagaagccaggt |
749406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University