View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_65 (Length: 364)
Name: NF1459_low_65
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 45625757 - 45625587
Alignment:
| Q |
1 |
cacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgctttgtgccttaaaatgcggtatatgccttctcccaatgctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625757 |
cacctggaaattctaacttgtagattaaatgggtgtggcttcttttcccactctctgctttgtgccttaaaatgcggtatatgccttctcccaatgctct |
45625658 |
T |
 |
| Q |
101 |
ggcatcactagtatgtctctttcctctactcttagtttcatactctcctgccaatccattcatagaaagat |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625657 |
ggcatcactagtatgtctctttcctctactcttagtttcatactctcctgccaatccattcatagaaagat |
45625587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 237 - 347
Target Start/End: Complemental strand, 45625521 - 45625411
Alignment:
| Q |
237 |
gcacttctcacctcctttaagagcatttttcacatgatctgcatttgtggtaaccatttctacaaaaccccaatatggcctgcttttctcgttcggatca |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625521 |
gcacttctcacctcctttaagagcatttttcacatgatctgcatttgtggtaaccatttctacaaaaccccaatatggcctgcttttctcgttcggatca |
45625422 |
T |
 |
| Q |
337 |
gggaggctttt |
347 |
Q |
| |
|
||||||||||| |
|
|
| T |
45625421 |
gggaggctttt |
45625411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University