View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_70 (Length: 344)
Name: NF1459_low_70
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 11 - 329
Target Start/End: Original strand, 40510251 - 40510569
Alignment:
| Q |
11 |
caaagggtgtcaaataatcaaaaagtttgcaggttgccatgatgaagatgaggaatcaagatcgtttatatacttggttgatgctttgaataaggaacaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510251 |
caaagggtgtcaaataatcaaaaagtttgcaggttgccatgatgaagatgaggaatcaagatcgtttatatacttggttgatgctttgaataaggaacaa |
40510350 |
T |
 |
| Q |
111 |
aatgtaaagggtgattgaaaccgtcgcaactttgtactgtaatttcattactggaaatttatttgttttatcccctatttaaatttaaataacatagagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510351 |
aatgtaaagggtgattgaaaccgtcgtaactttgtactgtaatttcattactggaaatttatttgttttatcccctatttaaatttaaataacatagagt |
40510450 |
T |
 |
| Q |
211 |
tactttggtcaaaggnnnnnnngcatatagttacaaacatttatactgaattttgttcatcttttattgtgtcttttctatataatttcaaacattagaa |
310 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510451 |
tactttggtcaaaggaaaaaaagcatatagttacaaacatttatactgaattttgttcatcttttattgtgtcttttctatataatttcaaacattagaa |
40510550 |
T |
 |
| Q |
311 |
cttgattcattataaatta |
329 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40510551 |
cttgattcattataaatta |
40510569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University