View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_79 (Length: 320)
Name: NF1459_low_79
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 4 - 191
Target Start/End: Complemental strand, 29947518 - 29947331
Alignment:
| Q |
4 |
tgtggcgacctatgtcgacgcaaaacgcagctaccggcggcgacaattcagcgaaggcagtagtcgccgagcaaatctcacagacagtgcaatcaacatc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947518 |
tgtggcgacctatgtcgacgcaaaacgcagctaccggcggcgacaattcagcgaaggcagtagtcgccgagcaaatctcacagacagtgcaatcaacatc |
29947419 |
T |
|
| Q |
104 |
aaaccttcttcacctcatgcaaaactcttctcctgctcaggtactttcttctcttcctcaatatcattcataattcaaattcaacatc |
191 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947418 |
aaaccttcttcacctcatgcaacactcttctcctgctcaggtactttcttctcttcctcaatatcattcataattcaaattcaacatc |
29947331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 252 - 320
Target Start/End: Complemental strand, 29947270 - 29947202
Alignment:
| Q |
252 |
tgtttagcgaaccttttgctaattagtaaagtgtcaatgaagacacactggacatgacactgacacgtc |
320 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947270 |
tgtttagtgaaccttttactaattagtaaagtgccaatgaagacacactggacatgacactgacacgtc |
29947202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University