View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_80 (Length: 317)
Name: NF1459_low_80
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 300
Target Start/End: Original strand, 2552008 - 2552292
Alignment:
| Q |
16 |
atgtctcatctcgaacaaggttgttggttcagatggattctgatgatggtccttcaattttgatatgtcacaagtgtggtgagaaactaaaaaaccttaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2552008 |
atgtctcatctcgaacaaggttgttggttcagatggattctgatgatggtccttcaattttgatatgtcacaagtgtggtgagaaactgaaaaaccttaa |
2552107 |
T |
 |
| Q |
116 |
tgatgttgaaactcaccatatcactgaacattattcaggtaatgataaattgcttcctagttaaatttacctgttttgtttatggtgcttctcaatttaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2552108 |
tgatgttgaaactcaccatatcactgaacattattcaggtaatgataaattgcttcctagttaaatttacctgttttgtttatggtgcttctcaatttaa |
2552207 |
T |
 |
| Q |
216 |
gtcttgttcttgatctgtccttaatttctttatgttatgctttggttgttgcatttaacatgtgttgatttctagagctctgatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2552208 |
gtcttgttcttgatctgtccttaatttctttatgttatgctttggttgttgcatttaacatgtgttgatttctagagctctgatt |
2552292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 16 - 147
Target Start/End: Original strand, 2562801 - 2562935
Alignment:
| Q |
16 |
atgtctcatctcgaacaaggttgttggttcagatggattctgatga---tggtccttcaattttgatatgtcacaagtgtggtgagaaactaaaaaacct |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||| || | |||||||||| ||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
2562801 |
atgtctcatctagaacaaggttgttggttgagatggattctgaggactgttgtccttcaatattgatatgttacaaatgcggtgagaaactaaaaaacct |
2562900 |
T |
 |
| Q |
113 |
taatgatgttgaaactcaccatatcactgaacatt |
147 |
Q |
| |
|
|| || ||||||| | |||||||||||||| |||| |
|
|
| T |
2562901 |
tactgctgttgaagcacaccatatcactgagcatt |
2562935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University