View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_low_96 (Length: 283)
Name: NF1459_low_96
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_low_96 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 11334933 - 11334656
Alignment:
| Q |
1 |
atgactgtaatgtgggaatgttgcttgagggtggtgctgagttgtggccttggtatgcttctaagtgggggaaagacttggtgagtttggaggggacgat |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
11334933 |
atgacggtaatgtgggaatgttgcttgagggtggtggtaagttgtgcccttggtatgcttctaagtggtggaaagacttggtgagtttggaggggacggt |
11334834 |
T |
 |
| Q |
101 |
tgggctcagttggttcaattccaaggttgttagaagggtgggtaatgggatgaagacgagtttttggaatgatatttggagaggggttgttccattacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11334833 |
tgggctcagttggttcaattccaaggttgttagaagggtgggtaatgggatgaaaacgagtttttggaatgatatttggagaggggttgttccattacga |
11334734 |
T |
 |
| Q |
201 |
accaagtatccacgattatatgcaatttcaaaccagaaagatctttctatatcggagatgatgaaggtgaacgattta |
278 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11334733 |
accaagtatccgcgattatatgcaatttcaaaccagaaagatctttctatatcggagatgatggaggtgaacgattta |
11334656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University