View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14601_high_3 (Length: 376)
Name: NF14601_high_3
Description: NF14601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14601_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 224 - 357
Target Start/End: Original strand, 4809630 - 4809763
Alignment:
| Q |
224 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaagttcggagtaccatactctcaagctataatgtttatatattttt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
4809630 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaggttcggagtaccctagtctcaagctttaatgtttatatattttt |
4809729 |
T |
|
| Q |
324 |
ggtgtcaatttctacattgagttggttcatatag |
357 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
4809730 |
ggtgtcaatttctacattgagtcggttcatatag |
4809763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 4809427 - 4809475
Alignment:
| Q |
22 |
accccacaaacctaaccaaactttctaaaagggacatccttcggggtga |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4809427 |
accccacaaacctaaccaaactttctaaaagggacatccttcggggtga |
4809475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University