View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_high_10 (Length: 253)
Name: NF14602_high_10
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 47107410 - 47107630
Alignment:
| Q |
16 |
tatactcgcaatccttcaacaacaaataaacataaaatatactcgcaactaaaccattagattgtaacgacgaacgaagataacaagtagttgtagggac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47107410 |
tatactcgcaatccttcaacaacaaataaacataaaatatactcgcaactaaaccattagattgtaacgacgaacgaagataacaagtagttgtagggac |
47107509 |
T |
|
| Q |
116 |
taaagtggcattaagttgataatattgaggataagtttgaacctaagtgaataattcgagcatttgatgacggattttgaatgatcatgaatcgttttag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47107510 |
taaagtggcattaagttgataatattgaggataagtttgaacctaagtgaataattcgagcatttgatgacagattttgaatgatcatgaatcgttttag |
47107609 |
T |
|
| Q |
216 |
aactttgttaatatgattgct |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47107610 |
aactttgttaatatgattgct |
47107630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University