View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_high_11 (Length: 243)
Name: NF14602_high_11
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 27744591 - 27744765
Alignment:
| Q |
14 |
agcagcagagaatgaatcaaattctactacagacgaagaagaagatacatacacagatgaagatactgacacacttgatatgcaggtacttttatgccca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27744591 |
agcagcagagaatgaatcaaattctactacagacgaagaagaagatacatacacagatgaagatactgacacacttgatatgcaggtacttttatgccca |
27744690 |
T |
 |
| Q |
114 |
aactgagatatttgcagggaccaagcacatgtttaannnnnnnnnnnncttccttcgttattagtgtttttgttgttatt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27744691 |
aactgagatacttgcagggaccaagcacatgtttaaattttttt-----ttccttcgttattagtgtttttgttgttatt |
27744765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 52
Target Start/End: Original strand, 49513434 - 49513466
Alignment:
| Q |
20 |
agagaatgaatcaaattctactacagacgaaga |
52 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
49513434 |
agagaatgaatcaaattctactacagatgaaga |
49513466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University