View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_high_9 (Length: 256)
Name: NF14602_high_9
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 38467321 - 38467561
Alignment:
| Q |
1 |
tacacgaattgaatggcattttagttgaatcttttgtgagctaatgagttaatgttattcaattcaggctttcttgtggttcaagtctgtacaagcagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38467321 |
tacacgaattgaatggcattttagttgaatcttttgtgagctaatgagttgatgttattcaattcaggctttcttgtggttcaagtctgtacaagcagcc |
38467420 |
T |
 |
| Q |
101 |
aacaaggaagctgaggaacaagacaagagggatggttattaataattatagagtaccttttttgttgctttatccgcgtaagtcatacggaaattgcata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38467421 |
aacaaggaagctgaggaacaagacaagagggatggttattaataattatagagtaccttttttgttgctttatccgcgtaagtcatatggaaattgcata |
38467520 |
T |
 |
| Q |
201 |
taatgctatgttgtaagtaagagtctattgtgaatattcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38467521 |
taatgctatgttgtaagtaagagtctattgtgaatattcat |
38467561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 241
Target Start/End: Original strand, 38468266 - 38468318
Alignment:
| Q |
189 |
ggaaattgcatataatgctatgttgtaagtaagagtctattgtgaatattcat |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38468266 |
ggaaattgcatataatattatgttgtaagtaagagtctattgtgaatattcat |
38468318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University