View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_low_5 (Length: 408)
Name: NF14602_low_5
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_low_5 |
 | |
|
| [»] scaffold0025 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0025 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 39 - 102
Target Start/End: Complemental strand, 149696 - 149635
Alignment:
| Q |
39 |
taaatccagggaaaagcaacgaaagagagagtttcttgaatgtgaagttcaaacacggcgtgat |
102 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
149696 |
taaatccagggaagagcaacgaaagagag--tttcatgaatgtgaagttcaaacacggcgtgat |
149635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 39 - 102
Target Start/End: Original strand, 13112472 - 13112533
Alignment:
| Q |
39 |
taaatccagggaaaagcaacgaaagagagagtttcttgaatgtgaagttcaaacacggcgtgat |
102 |
Q |
| |
|
||||||||||||| | ||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
13112472 |
taaatccagggaagaacaacgaaagag--agtttcttgaatgtgaagttcaaacacgacgtgat |
13112533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University