View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_low_7 (Length: 331)
Name: NF14602_low_7
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 313
Target Start/End: Complemental strand, 7527853 - 7527555
Alignment:
| Q |
15 |
cagagacaacgaatgagatagttcaaacattagttaaatagatcatatttttaatccgtctctatacttttgttgatgtaccgacatgtatcattgaacc |
114 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7527853 |
cagagacagcgaatgagataattcatacattagctaaatagatcatatttttaatccatctccatacttttgttgatgtaccgatatgtatcattgaacc |
7527754 |
T |
 |
| Q |
115 |
tatatctaatgaaatgcattaaacttttttccttacaacaacgtgggttcttttactttgcagataaaataaataaacctgatttttaacattgtattag |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7527753 |
tatatataatgaaatgcattaaacttttttccttacaacaacgtgggttcttttattttgcagataaaataaagaaagctgatttttaacattgtattag |
7527654 |
T |
 |
| Q |
215 |
tgttcttttatttgggtagacaatcattttgttctttaaatttgtttttagatagtcaatttagatatccctaaaagactagatgcctttgtaacttgt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7527653 |
tgttcttttatttgggtagacaatcattttattctttaaatttgtttttagatagtcaatttagatatccctaaaagactagatgcctttgtaacttgt |
7527555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 80 - 149
Target Start/End: Original strand, 21822327 - 21822396
Alignment:
| Q |
80 |
acttttgttgatgtaccgacatgtatcattgaacctatatctaatgaaatgcattaaacttttttcctta |
149 |
Q |
| |
|
|||||| | ||||||||| | ||||| ||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
21822327 |
acttttatcgatgtaccgtcgtgtattattgaactaatatctaatgaaatgctataaacttttttcctta |
21822396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University