View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14602_low_9 (Length: 272)
Name: NF14602_low_9
Description: NF14602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14602_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 9688623 - 9688391
Alignment:
| Q |
18 |
aattctggcctaatattttttaaaacgattgagccccttaaccttttgacatatacattttttaactaaataacttttgtaacaaagaaaatattggtgc |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9688623 |
aattttggcctaatattttttaaaacgattgagccccttaaccttttgacatatacattttttaactaaataacttttgtaacaaagaaaatattggtgc |
9688524 |
T |
|
| Q |
118 |
cnnnnnnnn-tggaaccatgtccaatttcacaccataaacatgctcatagttgtcactagtatatgcaaacactttaacactcaagtcagattatgagtg |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||| ||||||||||| |||||| |
|
|
| T |
9688523 |
caaaaaaatatggaaccatgtccaatttcacaccataaacatgctcatagctgtcactagtatatgcaaactcttcaaca--caagtcagattttgagtg |
9688426 |
T |
|
| Q |
217 |
aagtgggtgaaaattttaatagaatggaatgtgta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9688425 |
aagtgggtgaaaattttaatagaatggaatgtgta |
9688391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University