View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14604_high_10 (Length: 213)
Name: NF14604_high_10
Description: NF14604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14604_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 209
Target Start/End: Complemental strand, 50244979 - 50244816
Alignment:
| Q |
46 |
tcaattttcaacatgtatatccttctttgaaaattatcatggcctgcctcaaaaaaccattgctgaattcacctgaacttcaaagaactcttcaacaccc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50244979 |
tcaattttcaacatgtatatccttctttgaaaattatcatggcctgcctcaaaaaaccattgctgaattcacctgaacttcaaagaactcttcaacaccc |
50244880 |
T |
 |
| Q |
146 |
tctcttacgtccaagaactcacattttaacagtcccttttttacttctctctctgctcctcctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
50244879 |
tctcttacgtccaagaactcacattttaacagtcccttttttacttctctctctgtttctcctc |
50244816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University