View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14604_low_11 (Length: 255)
Name: NF14604_low_11
Description: NF14604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14604_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 31853272 - 31853042
Alignment:
| Q |
10 |
acatcatcatgaacgtgaacatgaacatgaagaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagaaacagatgatggtaga |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31853272 |
acatcaacatgaacgtgaacatgaacatgaagaggatgaaaatccttatgtttttgaagacagagattttgaaaccaaaatagatacagatgatggtaga |
31853173 |
T |
 |
| Q |
110 |
gttatggctctaaacatgtttgatcaaaaatcaaagctgctcagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853172 |
gttatggctctaaacatgtttgatcaaaaatcaaagctgcttagaaactttgagaattatggtttgaccattttagaagctaaaggacatgcttttgttt |
31853073 |
T |
 |
| Q |
210 |
caccacaccactttgattctgaggttatttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31853072 |
caccacaccactttgattctgaggttatttt |
31853042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University