View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14604_low_13 (Length: 209)

Name: NF14604_low_13
Description: NF14604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14604_low_13
NF14604_low_13
[»] chr8 (1 HSPs)
chr8 (25-139)||(473796-473912)


Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 25 - 139
Target Start/End: Complemental strand, 473912 - 473796
Alignment:
25 gggtgaatataaagagat--ggtaaaccttatttatatatgcaatcctaggctttattattattattttttgttgaagtaaactaaagttcttatgctct 122  Q
    ||||||||||||||||||  |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
473912 gggtgaatataaagagatatggtaaaccttatttatatatacaatcctaggcttttttattattattttttgttgaagtaaactaaagttcttatgctct 473813  T
123 ccaaacacgattgcacg 139  Q
    |||||||||||||||||    
473812 ccaaacacgattgcacg 473796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University