View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14604_low_13 (Length: 209)
Name: NF14604_low_13
Description: NF14604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14604_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 25 - 139
Target Start/End: Complemental strand, 473912 - 473796
Alignment:
| Q |
25 |
gggtgaatataaagagat--ggtaaaccttatttatatatgcaatcctaggctttattattattattttttgttgaagtaaactaaagttcttatgctct |
122 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
473912 |
gggtgaatataaagagatatggtaaaccttatttatatatacaatcctaggcttttttattattattttttgttgaagtaaactaaagttcttatgctct |
473813 |
T |
 |
| Q |
123 |
ccaaacacgattgcacg |
139 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
473812 |
ccaaacacgattgcacg |
473796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University