View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_high_15 (Length: 268)
Name: NF14605_high_15
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 17106521 - 17106766
Alignment:
| Q |
17 |
ttagcttcaaccgaaatgatggattattttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106521 |
ttagcttcaaccgaaatgatggattattttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttg |
17106620 |
T |
 |
| Q |
117 |
aatatgctgagcagcagcagatcagaagatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106621 |
aatatgctgagcagcagcagatcagaagatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaat |
17106720 |
T |
 |
| Q |
217 |
ctacatacagaatttgaagtccaagcttccttttacttcttctcac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17106721 |
ctacatacagaatttgaagtccaagcttccttttacttcttatcac |
17106766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University