View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_high_16 (Length: 265)
Name: NF14605_high_16
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 32229303 - 32229064
Alignment:
| Q |
18 |
atcactaaaggaatcttttttattcaaatctaatccaagaattttgcttcattggccaaaactatatggagttctgatataccaccttcaaaatcctttt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| ||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32229303 |
atcactaaaggaatctattttattcaaatttaatccaggaactttgcttcattgaccaaaactatatggagtcctgatataccaccttcaaaatcctttt |
32229204 |
T |
|
| Q |
118 |
tagtgtggacactgatgcaagaaaaatttccaactggtgataatctgaatactagagggtgcaacaacctttcaatcggttctacttatttagcttgcaa |
217 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
32229203 |
tagtgtggacaccgatgcaagacaaatttccaactgatgataatctgaatactagagggtgcaacaatctttcaatgggttctacttgtttagcttgcaa |
32229104 |
T |
|
| Q |
218 |
tgaatcaacttttcacttattttttgaatgttcctttgct |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229103 |
tgaatcaacttttcacttattttttgaatgttcctttgct |
32229064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University