View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_high_20 (Length: 227)
Name: NF14605_high_20
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_high_20 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 154 - 227
Target Start/End: Complemental strand, 41534002 - 41533929
Alignment:
| Q |
154 |
atgtttatgttttttcttttgtaaacttctctctgtctgttttctgaagcttactacgaacagatccctatttc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534002 |
atgtttatgttttttcttttgtaaacttctctctgtctgttttctgaagcttactacgaacagatccctatttc |
41533929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 41534157 - 41534123
Alignment:
| Q |
1 |
ctctgtcaccaccttccttcttcctttctctcact |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41534157 |
ctctgtcaccaccttccttcttcctttctctcact |
41534123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University