View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_low_25 (Length: 239)
Name: NF14605_low_25
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32264328 - 32264108
Alignment:
| Q |
1 |
cgaggattgcaaaaagatttttcgatgaggaattaaattaagattcgactagaannnnnnnggagtacatacataatacaagttcaattgggcctgccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32264328 |
cgaggattgcaaaaagatttttcgatgaggaattaaattaagattcgactagaatttttttggagtacatacataatacaagttcaattgggcctgccac |
32264229 |
T |
 |
| Q |
101 |
tgtcattatctatagtcatgtataacgattctctttccttatacataatgtgaaattaaaattggaagaagaaaatgactagaggaaatagagatttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32264228 |
tgtcattatctatagtcatgtataacgattctctttccttatacataatgtgaaattaaaattggaagaagaaaatgactagaggaaatagagatttcaa |
32264129 |
T |
 |
| Q |
201 |
ttgctcaaagtcatcaagcca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32264128 |
ttgctcaaagtcatcaagcca |
32264108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University