View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_low_27 (Length: 227)
Name: NF14605_low_27
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 23452309 - 23452512
Alignment:
| Q |
10 |
gagcagagacattttaggagattgatgaatggctacactagacctgagaaagaacttaaatgatttccaccctcttctgaaaacgccatgctaaatccta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23452309 |
gagcagagacattttaggagattgatgaatggctacactagacctgagaaagaacttaaatgatttccaccctcttctgaaaacgccatgctaaatccta |
23452408 |
T |
|
| Q |
110 |
accaatttgcttttacgtaccaaactcttgaggaaaaaacagacattcaaaactaggtgatcaacggatttcccctcaccataacc----actaacgcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23452409 |
accaatttgcttttacgtaccaaactcttgaggaaaaaacagacattcaaaactaggtgatcaacggatttcccctcaccataaccaaccactaacgcaa |
23452508 |
T |
|
| Q |
206 |
actt |
209 |
Q |
| |
|
|||| |
|
|
| T |
23452509 |
actt |
23452512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University