View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_low_29 (Length: 226)
Name: NF14605_low_29
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 6585688 - 6585496
Alignment:
| Q |
18 |
atcccccgttgaactgaaatatgtgaaacatttgacacataagaactcatcagaagcaccggaacataaagttgaatttctgagagtagatacttgagta |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585688 |
atcccccgttgaactgaaatctgtgaaacatttgacacataagaactcatcagatgcaccggaacataaagttgaatttctgagagtagatacttgagta |
6585589 |
T |
 |
| Q |
118 |
gaatctctcttctggtgattaccgtctgaacttccagcatcaagtccttcactgttttcatgaatacatgtgtaatttagatatttatataag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585588 |
gaatctctcttctggtgattaccgtctgaacttccagcatcaagtccttcaccgttttcatgaatacatgtgtaatttagatatttatataag |
6585496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 51169285 - 51169328
Alignment:
| Q |
140 |
cgtctgaacttccagcatcaagtccttcactgttttcatgaata |
183 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
51169285 |
cgtctgaacttccagcatcaagtcctctactgtttgcatgaata |
51169328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University