View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_low_3 (Length: 549)
Name: NF14605_low_3
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 34 - 139
Target Start/End: Original strand, 35764688 - 35764795
Alignment:
| Q |
34 |
taactatagatttataaatttc--aaaaaggtttcggcctaattccctttttcttttatgtactcctttaattttgttttaatgaattttgaatgatgct |
131 |
Q |
| |
|
|||||| || ||| |||||||| ||||||||||||||||| | ||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35764688 |
taactacaggtttgtaaatttctgaaaaaggtttcggcctagtcccccttttcttttatgtactcctttgattttgttttaatgaattttaaatgatgct |
35764787 |
T |
|
| Q |
132 |
ctctacat |
139 |
Q |
| |
|
|||||||| |
|
|
| T |
35764788 |
ctctacat |
35764795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 167 - 226
Target Start/End: Original strand, 35764807 - 35764866
Alignment:
| Q |
167 |
tctactcaataaaaacttgtatttcaatggttagatgaataaaatcaaatgtttctccct |
226 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35764807 |
tctactcaataaaaactagtatttcaatggttagatgaataaaatcaaatgtttctccct |
35764866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University