View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14605_low_30 (Length: 216)
Name: NF14605_low_30
Description: NF14605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14605_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 23900046 - 23900216
Alignment:
| Q |
16 |
atgaatgcaaatgaaataagtaagatcttgaatcaataacagatttatcatagactgatatatcttaatatttggacttaggacctagctcaatccaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23900046 |
atgaatgcaaatgaaataagtaagatcttgaatcaataacagatttatcatagactgatatatcttaatatttggacttaggacctagctcaatccaaca |
23900145 |
T |
 |
| Q |
116 |
aaaccgacttttgatgtgaggactattcaagtcttctaagaactatctagcccatatttctagtcactgtg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23900146 |
aaaccgacttttgatgtgaggactattcaagtcttctaagaactatctagcccatatttctagtcactgtg |
23900216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University