View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_high_15 (Length: 259)
Name: NF14607_high_15
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 13726411 - 13726161
Alignment:
| Q |
1 |
ccaaaatggagtaaaaatcacactagtgaacaccatttccatttggaacaaaatcaacaacaacattgatctaaattcaattcaaactgaaagcatttca |
100 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
13726411 |
ccaaaaaggagtaaaaataacactagtgaacaccatttccatttggaacaaaatcaacaacaacattgatctcaattcaattgaaactgaaagcatttca |
13726312 |
T |
|
| Q |
101 |
gatggttatgacaatggaggaatgtcatcagcagaaaatatggaatcttacaaagacactttctggaaagttggaccaaaatcactttctcagcttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726311 |
gatggttatgacaatggaggaatgtcatcagcagaaaacatggaatcttacaaagacactttctggaaagttggaccaaaatcactttctcagcttcttc |
13726212 |
T |
|
| Q |
201 |
ataaacttcaaagttcaaacaaccctgttgattgtgttgtctgtgctgctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
13726211 |
ataaacttcaaagttcaaacaaccctgttgattgtgttgtctatgatgctt |
13726161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University