View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_high_21 (Length: 210)
Name: NF14607_high_21
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 14 - 175
Target Start/End: Complemental strand, 34966880 - 34966719
Alignment:
| Q |
14 |
cagagacagatatgtaatttttaccatttgaaagagtgagtttgattaatcagagagaataatagttgagcaagttgtggtacaaatagcaatatcagag |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966880 |
cagagacagatatgtaaattttaccatttgaaagagtgagtttgattaatcagagagaataatagttgagcaagttgtggtacaaatagcaatatcagag |
34966781 |
T |
|
| Q |
114 |
atatgattttgaaatgattaattggctttgagaatagatttggatgtaagtgaaggatcttg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34966780 |
atatgattttgaaatgattaattggctttgagaatagatttggatgtaagtgaaggatcttg |
34966719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 138
Target Start/End: Complemental strand, 18425127 - 18425093
Alignment:
| Q |
104 |
aatatcagagatatgattttgaaatgattaattgg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18425127 |
aatatcagagatatgattttgaaatgattgattgg |
18425093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University