View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_10 (Length: 387)
Name: NF14607_low_10
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 29333670 - 29334033
Alignment:
| Q |
1 |
ttcgtttgttgactatttcttccaagtagttgcgcggtggcgggtttatatccggttcgaaagggttgcgaagtgaagattctagtggtggaggtggcg- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
29333670 |
ttcgtttgttgactatttcttccaagtagttgcgcggtggcgggtttatatccggttcgaaagggttgcgaagggaagattctagcggtggaggtggcgg |
29333769 |
T |
 |
| Q |
100 |
--gcggtggcggagatgtgacggaggcggaagtggaggttcggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttcc |
197 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29333770 |
cggcggtggtggagaggtgacggaggcggaagtggaggttcggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttcc |
29333869 |
T |
 |
| Q |
198 |
acgtcagcttttctgttgaattttagaagaaagacagtggcagtattgtaatttgtgaagaagggtttttctcttattatatagggttaatgggggttaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29333870 |
acgtcagcttttctgttgaattttagaagaaagacagtggcagtattgtaatttgtgaagaagggtttttctcttattatata----------gggttaa |
29333959 |
T |
 |
| Q |
298 |
tgtagtggcagtaaaaacccgttactcagttctgtctggtcaaagttgttatttgcgactagttacttgagctcttc |
374 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
29333960 |
tgtagtggcagtaaaaacccgt---tcagttctgtctagtcaaagttgttatttgcgggtggttacttgagctcttc |
29334033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University