View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_12 (Length: 371)
Name: NF14607_low_12
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 192 - 366
Target Start/End: Original strand, 40317303 - 40317477
Alignment:
| Q |
192 |
tggcggaaggaaactccggcgccgatatccaccgtatactcgccgccgttaaatcctccgaggcaagttacttccatttctcgcttcaatttttctactc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317303 |
tggcggaaggaaactccggcgccgatatccaccgtatactcgccgccgttaaatcctccgaggcaagttacttccatttctcgcttcaatttttctactc |
40317402 |
T |
|
| Q |
292 |
gtcaactaccttttcattctcttcacgaattttagggtttcgcgctaaaatttccacttcgtttttctttcattt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317403 |
gtcaactaccttttcattctcttcacgaattttagggtttcgcgctaaaatttccacttcgtttttctttcattt |
40317477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 40317129 - 40317211
Alignment:
| Q |
18 |
gttcagagttcacattgaattgactcgggtcgacccgatcggaccaattttgcgttgagaaaagagcgggaaaagcacggaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317129 |
gttcagagttcacattgaattgactcgggtcgacctgatcggaccaattttgcgttgagaaaagagcgggaaaagcacggaac |
40317211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University