View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_13 (Length: 361)
Name: NF14607_low_13
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 7 - 357
Target Start/End: Complemental strand, 14162548 - 14162198
Alignment:
| Q |
7 |
cattcggtatatcgagcgataaatcatcgacggtttcaatcaaccttgtgaacccttttgacatttggcttgtgttaatgaaacctttttcagcggcttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14162548 |
cattcggtatatcgagcgataaatcatcgacggtttcaatcaaccttgtgaacccttttgacatttggcttgtgttaatgaaacctttttcagcagcttc |
14162449 |
T |
|
| Q |
107 |
tttcaataggtctaataacggcgtttccgcttgtcgcttttccatcgccattataagagctcttttcactatttcatgatggaagaatggaacattcaaa |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14162448 |
tttcaataagtctaataacggcgtttccgcttgtcgcttttccatcgccattataagagctcttttcactatttcatgatggaagaatggaacattcaag |
14162349 |
T |
|
| Q |
207 |
tctttgatgcatctaaaagcttctgtcttgtcactgcttactacatatgacttcaagaaattgtttatccatgccttcacatcatcaactgatgtattct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||||| ||||||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
14162348 |
tctttgatgcatctaaaagcttctgtcttgtcgccacttacaacatattctttcaagaaattatttatccttgccttcacatcatcaactgttgtattct |
14162249 |
T |
|
| Q |
307 |
ttctgcctccccaacgctgctcgttgatttccgcatgtagagttgctgtta |
357 |
Q |
| |
|
| || |||||||||||| ||||| ||||||| || |||| || |||||||| |
|
|
| T |
14162248 |
tactacctccccaacgccgctcgatgatttcagcgtgtaaaggtgctgtta |
14162198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University