View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_29 (Length: 256)
Name: NF14607_low_29
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 46614006 - 46614230
Alignment:
| Q |
14 |
catagggaagagtttgaacatctttaagagtccaccagcggagaatttgttgcgcttttgatcgcctgttgtatggcgaaggagtgatgctattgctgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46614006 |
catagggaagagtttgaacatctttaagagtccaccagcggagaatttgttgcgcttttgatcgcctgttgtatggcgaaggagtgatgctattgctgga |
46614105 |
T |
 |
| Q |
114 |
ttttccattggatagcatggactagagtgcacagatggcattatggaatatgataatgaatattaatcgttatgaaattgtgctaagttaaggtaacacg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46614106 |
ttttccattggatagcatggactagagtgaacagatggcattatggaatatgataatgaatattaatcgttatgaaattgtgctaagttaaggtaacacg |
46614205 |
T |
 |
| Q |
214 |
attctaggaagacagagtggtgggt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46614206 |
attctaggaagacagagtggtgggt |
46614230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University