View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_32 (Length: 235)
Name: NF14607_low_32
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 2891459 - 2891667
Alignment:
| Q |
19 |
caaaggatccatagatatacagtagctatatatcccagcaaaaacagagggtgaaataatcaactgtttggttgatttaactgttgatgattatggatcc |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891459 |
caaaggatccatagatagacagtagctatatatcccagcaaaaacagagggtgaaataatcaactgtttggttgatttaactgttgatgattatggatcc |
2891558 |
T |
 |
| Q |
119 |
aattgcacacattacataaaatcattcgcttctaaaatatgtgcagggatttcaaaattcaacctattacaactttcatagctttctctctcatcttctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891559 |
aattgcacacattacataaaatcattcgcttctaaaatatgtgcagggatttcaaaattcaacctattacaactttcatagctttctctctcatcttctg |
2891658 |
T |
 |
| Q |
219 |
tgctgctcc |
227 |
Q |
| |
|
|| |||||| |
|
|
| T |
2891659 |
tgttgctcc |
2891667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University