View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_34 (Length: 212)
Name: NF14607_low_34
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 31047111 - 31046915
Alignment:
| Q |
1 |
ttcctttacgctacagcacgtgtttctgttcctgaagcttttattcttcactcactttcacgtgagagttgggaccgtgagtctaactggattggttaca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31047111 |
ttcctttatgctacagcacgtgtttctgttcctgaagcttttattcttcactcactttcacgtgagagttgggaccgtgagtctaactggattggttaca |
31047012 |
T |
 |
| Q |
101 |
tcgctgttagttccgatgaacggagtagagagttgggtcgtcgtgaaatatatgttgtgtggcgtggtaccacgagggaccttgaatggattaacgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31047011 |
tcgctgttagttccgatgaacggagtagagagttgggtcgtcgtgaaatatatgttgtgtggcgtggtaccacgagggaccttgaatggattaacgt |
31046915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University