View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14607_low_9 (Length: 389)
Name: NF14607_low_9
Description: NF14607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14607_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 11975749 - 11976124
Alignment:
| Q |
1 |
gataagttgatctataatttcnnnnnnnctcccaactatagccggttccaactccgtctcctcccccgtcttctcccatgcttcttgaggcggcatagtt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975749 |
gataagttgatctataatttctttttttctcccaactatagccggttccaactccgtctcctcccccgtcttctcccatgcttcttgaggcggcatagtt |
11975848 |
T |
|
| Q |
101 |
gcagtggtggtcgtggacaattcttttaaaacatctttgagatcttttatggcattttgaattcttgagttgatggctttaagctgatgcttatgacgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975849 |
gcagtggtggtcgtggacaattcttttaaaacatctttgagatcttttatggcattttgaattcttgagttgatggctttaagctgatgcttatgacgat |
11975948 |
T |
|
| Q |
201 |
cggcttgaaacggagagaaagttcttttctgaggcttaagaataccggcatcgagttcctccaccaatttgttcagatctttgagggcagttttaaggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11975949 |
cggcttgaaacggagagaaagttcttttctgaggcttaagaataccggcatcgagttcctccaccaatttgttcagatctttgagggcagttttaaggtt |
11976048 |
T |
|
| Q |
301 |
ggacagaacctcatgacgttggacgtggttcttaaccaggtcttggattttttcaagagaagttataagttggttc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976049 |
ggacagaacctcatgacgttggacgtggttcttaaccaggtcttggattttttcaagagaagttataagttggttc |
11976124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University